Chapter 5 —— 144 —— Map and nucleotide sequence of selector AAV donor construct BI38_pAAV-HRA1.IN17. Diagram of AAV-HRA1.IN17 vector genome containing an ATP1A1-targeting HR donor template. The selector donor DNA sequence (3129 bp bp) is designed for concomitant HRmediated installation of a transgene and an ouabain resistance gain-of-function SPN (T804N) within exon 17 and intron 17 of ATP1A1 alleles, respectively. The matched gRNA GA1.IN17 directs DNA cleavage at the ATP1A1 intron 17. U6 promoter, human U6 snRNA polymerase III promoter driving the expression of gRNAA1.IN17 AAV ITR, adeno-associated virus type-2 inverted terminal repeat; DNA sequences homologous to target ATP1A1 alleles (homology arms) flank a transgene consisting of the human phosphoglycerate kinase 1 gene promoter (hPGK); the mScarlet-1 reporter coding sequence (red arrow), and the bovine growth hormone gene polyadenylation signal (bGH pA). The vector plasmid backbone is not shown. References 1. Pacesa M, Pelea O, Jinek M. Past, present, and future of CRISPR genome editing technologies. Cell 2024 187:1076-1100. 2. Hongyu Liao, Jiahao Wu, Nathan J. VanDusen, Yifei Li, Yanjiang Zheng CRISPR/Cas9-mediated homology-directed repair for precise gene editing. Mol Ther Nucleic Acids 2024 DOI: 10.1016/j.omtn.2024.102344. 3. He X., Tan C., Wang F., Wang Y., Zhou R., Cui D., You W., Zhao H., Ren J., Feng B. Knockin of large reporter genes in human cells via CRISPR/Cas9-induced homologydependent and independent DNA repair. Nucleic Acids Res. 2016; 44:e85. 4. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, Hatanaka F, Yamamoto M, Araoka T, Li Z, Kurita M, Hishida T, Li M, Aizawa E, Guo S, Chen S, Goebl A, Soligalla RD, Qu J, Jiang T, Fu X, Jafari M, Esteban CR, Berggren WT, Lajara J, Nuñez-Delicado E, Guillen P, Campistol JM, Matsuzaki F, Liu GH, Magistretti P, cgttgggaaaagaaattctcaggaccagtatccagtgtgtgtcccaatcccggcttcacagaatcagtattac cactcttcaaggcagcagttaacatttgtttatcagatgggaatctttatttttgtatacttcacctaaaaga tttttaaatgggagggcaagaattttataacaaaaggttcacaatattagcttccttatttttagtaactaaa ttccttctccccaccccttcccaggttcctgccatctccctggcttatgagcaggctgagagtgacatcatga agagacagcccagaaatcccaaaacagacaaacttgtgaatgagcggctgatcagcatggcctatgggcagat tggtaagctgcagcctggagtgggaagctggcacatctaaggcatctgaggtgatggtgtccacctcaggttg aggttgatttcagagactgcaaatccaggcgactttcaggtctaggatgagccctaacggagtgagcctgtgg agtttctctgaactctcttccatgtgagaatacatctgttgctgtttgcccagttaccttttgtggaaactgg ttttctatactgagcaccttggaactgggctcaactctgcctgagaaatgaggatgtccttcctcactgagcc ttgcggaacaggaggcatggttctaagggctagtcctagccacgtgaccggttcgcgaggatccatatatagg gcccgggttataattacctcaggtcgacgtcccatgtgcaggtgctgaattgtagataagtagcatggcgggt taatcattaactacaaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactga ggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag
RkJQdWJsaXNoZXIy MTk4NDMw