Chapter 5 —— 137 —— Supplementary Table S10. Primers and PCR mixtures used for clonal screening of ATP1A1::mScarlet (Figures 4E and Supplementary figure S4) Target Primer code Primers (5’ → 3’) / final concentrations (µM) 2X Phire Tissue Direct PCR Master mix µl Amplicon size (bp) mScarlet #2120 ACGGTGTAGTCCTCGTTGTG / 0.5 10 1095 #1648 TCTCGCACATTCTTCACGTC / 0.5 jT.ATP1A1 #2229 ACTACAGGGCGTGCATACAG / 0.5 10 1199 #2230 CCCACAACGAGGACTACACC / 0.5 jC.ATP1A1 #2234 GGTGACCTACCAGCCAAACT / 0.5 10 945 #2235 CTTGGAAAAGGCGCAACCC / 0.5 Supplementary Table S11. PCR cycling parameters used for clonal screening of ATP1A1::mScarlet (Figures 4E and Supplementary figure S4) Target Initial denaturation Denaturation Annealing Elongation Cycles Final elongation mScarlet 98 ℃ 98 ℃ 72 ℃ 30 72 ℃ 5 min 7 sec 32 sec 2 min jT.ATP1A1 98 ℃ 98 ℃ 67 ℃ 72 ℃ 30 72 ℃ 5 min 7 sec 5 sec 20 sec 2 min jC.ATP1A1 98 ℃ 98 ℃ 72 ℃ 35 72 ℃ 5 min 7 sec 20 sec 2 min
RkJQdWJsaXNoZXIy MTk4NDMw