Chapter 5 —— 134 —— Supplementary Table S4. Primers and PCR mixtures used for clonal screening of ATP1A1 (Figures 1E, 1F and Supplementary figure S2) Target Primer code Primers (5’ → 3’) / final concentrations (µM) dNTP ( mM) MgCl2 (mM) GoTaq Flexi Buffer GoTaq (Units) Amplicon size (bp) ATP1A1 #2225 CCCCTCCCGACAAAATCAATAC/0,4 0.4 1 1x 1.25 1275 #2228 TAGCACCACACCCAGGTACA/0,4 Supplementary Table S5. PCR cycling parameters used for clonal screening of ATP1A1 (Figures 1E, 1F and Supplementary figure S2) Target Initial denaturation Denaturation Annealing Elongation Cycles Final elongation ATP1A1 95 ℃ 95 ℃ 64 ℃ 72 ℃ 40 72 ℃ 5 min 30 sec 30 sec 1 min 20 sec 5 min
RkJQdWJsaXNoZXIy MTk4NDMw