Liza Kok

Cortical interneuron development is affected in 4H leukodystrophy 71 2 were passaged 1:2/1:3 into a new well when they reached confluency, using accutase dissociation. Half of the medium was refreshed every other day. At day 37 medium supplements were changed to EGF, FGF2, mouse Laminin, Vitamin C and T3. At day 39, Dorsomorphin was additionally added to the medium. At day 42, medium supplements were changed to mouse laminin, vitamin C, Dorsomorphin and T3. Cells were kept in these medium until day 67 when they were frozen or replated for neuron-OPC co-cultures. Neuron-glia co-culture For myelinating neuron-glia cultures, neurons and glia cells were differentiated from iPSCs as described in the supplementary methods. To promote neuronal maturation, neurons were plated on a monolayer of rat astrocytes. Rat astrocytes were isolated from postnatal day 1 rat cortex using papaïn dissociation. At 1 day and 4 days after dissociation, flasks with rat astrocytes were tapped to detach contaminating cells like oligodendrocytes or microglia as much as possible. Astrocytes were frozen at passage 1 until further use. To start a coculture, day 18 cortical neurons were plated in Neurobasal/B27 medium supplemented with BDNF, GDNF, cAMP and IGF1. At day 30 of neuronal differentiation, day 67 human glial progenitor cells were added to the culture, and medium was switched to Neurobasal/N1 medium supplemented with T3, NT3, mouse Laminin, BDNF and cAMP. The co-cultures were kept in culture for an additional 40 days and subsequently fixed for immunostaining. Supplementary Table 2. Primer sequences Target Forward primer Reverse primer ARX AAACGCAAACAGAGGCGCTA CAGTTCCTCCCTGGTGAAGAC NEUN TGGCATGACCCTGTACACAC GCTGCTGCTTCTCTGTAGGG EIF4G2 (housekeeping) AGGACCGCATGTTGGAGATT TGAGGGGATGGATCCAACTTT NRG1 CGTGGAATCAAACGCTACATCT TTCACCATGAAGCACTCCCC PDE1A CAGCAGTGGACCTGAAGAGTT TGTGAACTGGTTCTTGCTTCTTG ERBB4 GTTCAGGATGTGGACGTTGC ACACACCGTCCTTGTCAAAGT NDNF GTGCTTAGCATCTTGGCAGG TGGAGCAGCACCATCCTTAAA RELN1 CGTCCTAGTAAGCACTCGCA TCGCCTAAGTGACCTTCGTC NEUN GTCCCTTACTCCGCCAAGAG CAAGGTCCTCCTTCTCAGGC DLX2 ATCCAGAAATGTGCCTGCGG AGCATCCTTCCTCCATTGCTT CNTNAP2 PDPR MACIR ITGA11 CGTGGAATCAAACGCTACATCT TGTTGTGGCTGCCGCATTG GGGCCATCGTACCTGGA TCGTGCTCCACAGCTGAATC TTCACCATGAAGCACTCCCC GCGGGAAAACAGTTCCATCTCAC AAGCACCAGTCTGCACAATC GACCTCAACCACAGGTTCCC

RkJQdWJsaXNoZXIy MTk4NDMw